| Title: | Melting Temperature of Nucleic Acid Sequences |
|---|---|
| Description: | This tool is extended from methods in Bio.SeqUtils.MeltingTemp of python. The melting temperature of nucleic acid sequences can be calculated in three method, the Wallace rule (Thein & Wallace (1986) <doi:10.1016/S0140-6736(86)90739-7>), empirical formulas based on G and C content (Marmur J. (1962) <doi:10.1016/S0022-2836(62)80066-7>, Schildkraut C. (2010) <doi:10.1002/bip.360030207>, Wetmur J G (1991) <doi:10.3109/10409239109114069>, Untergasser,A. (2012) <doi:10.1093/nar/gks596>, von Ahsen N (2001) <doi:10.1093/clinchem/47.11.1956>) and nearest neighbor thermodynamics (Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746>, Sugimoto N (1996) <doi:10.1093/nar/24.22.4501>, Allawi H (1998) <doi:10.1093/nar/26.11.2694>, SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800>, Freier S (1986) <doi:10.1073/pnas.83.24.9373>, Xia T (1998) <doi:10.1021/bi9809425>, Chen JL (2012) <doi:10.1021/bi3002709>, Bommarito S (2000) <doi:10.1093/nar/28.9.1929>, Turner D H (2010) <doi:10.1093/nar/gkp892>, Sugimoto N (1995) <doi:10.1016/S0048-9697(98)00088-6>, Allawi H T (1997) <doi:10.1021/bi962590c>, Santalucia N (2005) <doi:10.1093/nar/gki918>), and it can also be corrected with salt ions and chemical compound (SantaLucia J (1996) <doi:10.1021/bi951907q>, SantaLucia J(1998) <doi:10.1073/pnas.95.4.1460>, Owczarzy R (2004) <doi:10.1021/bi034621r>, Owczarzy R (2008) <doi:10.1021/bi702363u>). |
| Authors: | Junhui Li |
| Maintainer: | Junhui Li <[email protected]> |
| License: | GPL (>= 2) |
| Version: | 1.0.2 |
| Built: | 2024-12-12 06:27:50 UTC |
| Source: | https://github.com/junhuili1017/tmcalculator |
Simply convert a vector of characters such as c("H","e","l","l","o","W","o","r","l","d") into a single string "HelloWorld".
c2s(characters)c2s(characters)
characters |
A vector of characters |
Retrun a strings
Junhui Li
citation("TmCalculator")
c2s(c("H","e","l","l","o","W","o","r","l","d"))c2s(c("H","e","l","l","o","W","o","r","l","d"))
In general, whitespaces and non-base characters are removed and characters are converted to uppercase in given method.
check_filter(ntseq, method)check_filter(ntseq, method)
ntseq |
Sequence (5' to 3') of one strand of the DNA nucleic acid duplex as string or vector of characters |
method |
TM_Wallace: check and return "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W" and "Y" TM_GC: check and return "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W", "X" and "Y" TM_NN: check and return "A","C","G","I" and "T" |
Return a sequence which fullfils the requirements of the given method.
Junhui Li
citation("TmCalculator")
ntseq <- c("ATCGBDHKMNRVYWSqq") check_filter(ntseq,method='Tm_Wallace') check_filter(ntseq,method='Tm_NN')ntseq <- c("ATCGBDHKMNRVYWSqq") check_filter(ntseq,method='Tm_Wallace') check_filter(ntseq,method='Tm_NN')
Corrections coefficient of melting temperature with DMSO and formamide and these corrections are rough approximations.
chem_correction( DMSO = 0, fmd = 0, DMSOfactor = 0.75, fmdmethod = c("concentration", "molar"), fmdfactor = 0.65, ptGC )chem_correction( DMSO = 0, fmd = 0, DMSOfactor = 0.75, fmdmethod = c("concentration", "molar"), fmdfactor = 0.65, ptGC )
DMSO |
Percent DMSO |
fmd |
Formamide concentration in percentage (fmdmethod="concentration") or molar (fmdmethod="molar"). |
DMSOfactor |
Coefficient of Tm decreases per percent DMSO. Default=0.75 von Ahsen N (2001) <PMID:11673362>. Other published values are 0.5, 0.6 and 0.675. |
fmdmethod |
"concentration" method for formamide concentration in percentage and "molar" for formamide concentration in molar |
fmdfactor |
Coefficient of Tm decrease per percent formamide. Default=0.65. Several papers report factors between 0.6 and 0.72. |
ptGC |
Percentage of GC(%). |
fmdmethod = "concentration"
Correction = - factor*percentage_of_formamide
fmdmethod = "molar"
Correction = (0.453*GC/100 - 2.88) x formamide
Junhui Li
von Ahsen N, Wittwer CT, Schutz E , et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-C1961.
chem_correction(DMSO=3) chem_correction(fmd=1.25, fmdmethod="molar", ptGC=50)chem_correction(DMSO=3) chem_correction(fmd=1.25, fmdmethod="molar", ptGC=50)
get reverse complement and complement base of nucleotide sequences
complement(ntseq, reverse = FALSE)complement(ntseq, reverse = FALSE)
ntseq |
Sequence (5' to 3') of one strand of the nucleic acid duplex as string or vector of characters |
reverse |
Logical value, TRUE is reverse complement sequence, FALSE is not. |
Junhui Li
citation("TmCalculator")
complement("ATCGYCGYsWwsaVv") complement("ATCGYCGYsWwsaVv",reverse=TRUE)complement("ATCGYCGYsWwsaVv") complement("ATCGYCGYsWwsaVv",reverse=TRUE)
Calculate G and C content of nucleotide sequences. The number of G and C in sequence is divided by length of sequence(when totalnt is TRUE) or the number of all A,T,C,G and ambiguous base.
GC(ntseq, ambiguous = FALSE, totalnt = FALSE)GC(ntseq, ambiguous = FALSE, totalnt = FALSE)
ntseq |
Sequence (5' to 3') of one strand of the nucleic acid duplex as string or vector of characters. |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE. |
totalnt |
Sum of 'G' and 'C' bases divided by the length of the sequence when totalnt is TRUE. |
Content of G and C(range from 0 to 100
Junhui Li
GC(c("a","t","c","t","g","g","g","c","c","a","g","t","a"))#53.84615 GC("GCATSWSYK",ambiguous = TRUE)#55.55556GC(c("a","t","c","t","g","g","g","c","c","a","g","t","a"))#53.84615 GC("GCATSWSYK",ambiguous = TRUE)#55.55556
TmCalculator objectprint.TmCalculator prints to console the melting temperature value from an object of
class TmCalculator.
## S3 method for class 'TmCalculator' print(x, ...)## S3 method for class 'TmCalculator' print(x, ...)
x |
An object of class |
... |
Unused |
The melting temperature value.
Simply convert a single string such as "HelloWorld" into a vector of characters such as c("H","e","l","l","o","W","o","r","l","d")
s2c(strings)s2c(strings)
strings |
A single string such as "HelloWorld" |
Retrun a vector of characters
Junhui Li
citation("TmCalculator")
s2c(c("HelloWorld"))s2c(c("HelloWorld"))
Corrections coefficient of melting temperature or entropy with different operations
salt_correction( Na = 0, K = 0, Tris = 0, Mg = 0, dNTPs = 0, method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1", "SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"), ntseq, ambiguous = FALSE )salt_correction( Na = 0, K = 0, Tris = 0, Mg = 0, dNTPs = 0, method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1", "SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"), ntseq, ambiguous = FALSE )
Na |
Millimolar concentration of Na |
K |
Millimolar concentration of K |
Tris |
Millimolar concentration of Tris |
Mg |
Millimolar concentration of Mg |
dNTPs |
Millimolar concentration of dNTPs |
method |
Method to be applied including "Schildkraut2010", "Wetmur1991","SantaLucia1996", "SantaLucia1998-1", "SantaLucia1998-2","Owczarzy2004","Owczarzy2008". First fourth methods correct Tm, fifth method corrects deltaS, sixth and seventh methods correct 1/Tm. See details for the method description. |
ntseq |
Sequence (5' to 3') of one strand of the nucleic acid duplex as string or vector of characters. |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE. |
The methods are:
1 Schildkraut C (2010) <doi:10.1002/bip.360030207>
2 Wetmur J G (1991) <doi:10.3109/10409239109114069>
3 SantaLucia J (1996) <doi:10.1021/bi951907q>
4 SantaLucia J (1998) <doi:10.1073/pnas.95.4.1460>
5 SantaLucia J (1998) <doi:10.1073/pnas.95.4.1460>
6 Owczarzy R (2004) <doi:10.1021/bi034621r>
7 Owczarzy R (2008) <doi:10.1021/bi702363u>
methods 1-4: Tm(new) = Tm(old) + correction
method 5: deltaS(new) = deltaS(old) + correction
methods 6+7: Tm(new) = 1/(1/Tm(old) + correction)
Junhui Li
Schildkraut C . Dependence of the melting temperature of DNA on salt concentration[J]. Biopolymers, 2010, 3(2):195-208.
Wetmur J G . DNA Probes: Applications of the Principles of Nucleic Acid Hybridization[J]. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):3
Santalucia , J , Allawi H T , Seneviratne P A . Improved Nearest-Neighbor Parameters for Predicting DNA Duplex Stability, [J]. Biochemistry, 1996, 35(11):3555-3562.
SantaLucia, J. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics[J]. Proceedings of the National Academy of Sciences, 1998, 95(4):1460-1465.
Owczarzy R , You Y , Moreira B G , et al. Effects of Sodium Ions on DNA Duplex Oligomers: Improved Predictions ofMelting Temperatures[J]. Biochemistry, 2004, 43(12):3537-3554.
Owczarzy R , Moreira B G , You Y , et al. Predicting Stability of DNA Duplexes in Solutions Containing Magnesium and Monovalent Cations[J]. Biochemistry, 2008, 47(19):5336-5353.
ntseq <- c("acgtTGCAATGCCGTAWSDBSYXX") salt_correction(Na=390, K=20, Tris=0, Mg=10, dNTPs=25, method="Owczarzy2008", ntseq)ntseq <- c("acgtTGCAATGCCGTAWSDBSYXX") salt_correction(Na=390, K=20, Tris=0, Mg=10, dNTPs=25, method="Owczarzy2008", ntseq)
Calculate the melting temperature using empirical formulas based on GC content with different options
Tm_GC( ntseq, ambiguous = FALSE, userset = NULL, variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965", "Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"), Na = 0, K = 0, Tris = 0, Mg = 0, dNTPs = 0, saltcorr = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1", "Owczarzy2004", "Owczarzy2008"), mismatch = TRUE, DMSO = 0, fmd = 0, DMSOfactor = 0.75, fmdfactor = 0.65, fmdmethod = c("concentration", "molar") )Tm_GC( ntseq, ambiguous = FALSE, userset = NULL, variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965", "Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"), Na = 0, K = 0, Tris = 0, Mg = 0, dNTPs = 0, saltcorr = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1", "Owczarzy2004", "Owczarzy2008"), mismatch = TRUE, DMSO = 0, fmd = 0, DMSOfactor = 0.75, fmdfactor = 0.65, fmdmethod = c("concentration", "molar") )
ntseq |
Sequence (5' to 3') of one strand of the nucleic acid duplex as string or vector of characters. |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE. |
userset |
A vector of four coefficient values. Usersets override value sets. |
variant |
Empirical constants coefficient with 8 variant: Chester1993, QuikChange, Schildkraut1965, Wetmur1991_MELTING, Wetmur1991_RNA, Wetmur1991_RNA/DNA, Primer3Plus and vonAhsen2001 |
Na |
Millimolar concentration of Na, default is 0 |
K |
Millimolar concentration of K, default is 0 |
Tris |
Millimolar concentration of Tris, default is 0 |
Mg |
Millimolar concentration of Mg, default is 0 |
dNTPs |
Millimolar concentration of dNTPs, default is 0 |
saltcorr |
Salt correction method should be chosen when provide 'userset'. Options are "Schildkraut2010", "Wetmur1991","SantaLucia1996","SantaLucia1998-1","Owczarzy2004","Owczarzy2008". Note that "SantaLucia1998-2" is not available for this function. |
mismatch |
If 'True' (default) every 'X' in the sequence is counted as mismatch |
DMSO |
Percent DMSO |
fmd |
Formamide concentration in percentage (fmdmethod="concentration") or molar (fmdmethod="molar"). |
DMSOfactor |
Coeffecient of Tm decreases per percent DMSO. Default=0.75 von Ahsen N (2001) <PMID:11673362>. Other published values are 0.5, 0.6 and 0.675. |
fmdfactor |
Coeffecient of Tm decrease per percent formamide. Default=0.65. Several papers report factors between 0.6 and 0.72. |
fmdmethod |
"concentration" method for formamide concentration in percentage and "molar" for formamide concentration in molar |
Empirical constants coefficient with 8 variant:
Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N
QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch
Schildkraut1965: Tm = 81.5 + 0.41(Percentage_GC) - 675/N + 16.6 x log[Na+]
Wetmur1991_MELTING: Tm = 81.5 + 0.41(Percentage_GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+])) - Percentage_mismatch
Wetmur1991_RNA: Tm = 78 + 0.7(Percentage_GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+])) - Percentage_mismatch
Wetmur1991_RNA/DNA: Tm = 67 + 0.8(Percentage_GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+])) - Percentage_mismatch
Primer3Plus: Tm = 81.5 + 0.41(Percentage_GC) - 600/N + 16.6 x log[Na+]
vonAhsen2001: Tm = 77.1 + 0.41(Percentage_GC) - 528/N + 11.7 x log[Na+]
Junhui Li
Marmur J , Doty P . Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature.[J]. Journal of Molecular Biology, 1962, 5(1):109-118.
Schildkraut C . Dependence of the melting temperature of DNA on salt concentration[J]. Biopolymers, 2010, 3(2):195-208.
Wetmur J G . DNA Probes: Applications of the Principles of Nucleic Acid Hybridization[J]. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.
Untergasser A , Cutcutache I , Koressaar T , et al. Primer3–new capabilities and interfaces[J]. Nucleic Acids Research, 2012, 40(15):e115-e115.
von Ahsen N, Wittwer CT, Schutz E , et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
ntseq <- c("ATCGTGCGTAGCAGTACGATCAGTAG") out <- Tm_GC(ntseq,ambiguous=TRUE,variant="Primer3Plus",Na=50,mismatch=TRUE) out out$Tm out$Optionsntseq <- c("ATCGTGCGTAGCAGTACGATCAGTAG") out <- Tm_GC(ntseq,ambiguous=TRUE,variant="Primer3Plus",Na=50,mismatch=TRUE) out out$Tm out$Options
Calculate melting temperature using nearest neighbor thermodynamics
Tm_NN( ntseq, ambiguous = FALSE, comSeq = NULL, shift = 0, nn_table = c("DNA_NN4", "DNA_NN1", "DNA_NN2", "DNA_NN3", "RNA_NN1", "RNA_NN2", "RNA_NN3", "R_DNA_NN1"), tmm_table = "DNA_TMM1", imm_table = "DNA_IMM1", de_table = c("DNA_DE1", "RNA_DE1"), dnac1 = 25, dnac2 = 25, selfcomp = FALSE, Na = 0, K = 0, Tris = 0, Mg = 0, dNTPs = 0, saltcorr = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1", "SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"), DMSO = 0, fmd = 0, DMSOfactor = 0.75, fmdfactor = 0.65, fmdmethod = c("concentration", "molar") )Tm_NN( ntseq, ambiguous = FALSE, comSeq = NULL, shift = 0, nn_table = c("DNA_NN4", "DNA_NN1", "DNA_NN2", "DNA_NN3", "RNA_NN1", "RNA_NN2", "RNA_NN3", "R_DNA_NN1"), tmm_table = "DNA_TMM1", imm_table = "DNA_IMM1", de_table = c("DNA_DE1", "RNA_DE1"), dnac1 = 25, dnac2 = 25, selfcomp = FALSE, Na = 0, K = 0, Tris = 0, Mg = 0, dNTPs = 0, saltcorr = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1", "SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"), DMSO = 0, fmd = 0, DMSOfactor = 0.75, fmdfactor = 0.65, fmdmethod = c("concentration", "molar") )
ntseq |
Sequence (5' to 3') of one strand of the nucleic acid duplex as string or vector of characters. |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE.Default is FALSE. |
comSeq |
Complementary sequence. The sequence of the template/target in 3'->5' direction |
shift |
Shift of the primer/probe sequence on the template/target sequence, default=0. for example: when shift=0, the first nucleotide base at 5' end of primer align to first one at 3' end of template. When shift=-1, the second nucleotide base at 5' end of primer align to first one at 3' end of template. When shift=1, the first nucleotide base at 5' end of primer align to second one at 3' end of template. The shift parameter is necessary to align primer/probe and template/target if they have different lengths or if they should have dangling ends. |
nn_table |
Thermodynamic NN values, eight tables are implemented. For DNA/DNA hybridizations: DNA_NN1,DNA_NN2,DNA_NN3,DNA_NN4 For RNA/RNA hybridizations: RNA_NN1,RNA_NN2,RNA_NN3 For RNA/DNA hybridizations: R_DNA_NN1 |
tmm_table |
Thermodynamic values for terminal mismatches. Default: DNA_TMM1 |
imm_table |
Thermodynamic values for internal mismatches, may include insosine mismatches. Default: DNA_IMM1 |
de_table |
Thermodynamic values for dangling ends. DNA_DE1(default) and RNA_DE1 |
dnac1 |
Concentration of the higher concentrated strand [nM]. Typically this will be the primer (for PCR) or the probe. Default=25. |
dnac2 |
Concentration of the lower concentrated strand [nM]. |
selfcomp |
Sequence self-complementary, default=False. If 'True' the primer is thought binding to itself, thus dnac2 is not considered. |
Na |
Millimolar concentration of Na, default is 0 |
K |
Millimolar concentration of K, default is 0 |
Tris |
Millimolar concentration of Tris, default is 0 |
Mg |
Millimolar concentration of Mg, default is 0 |
dNTPs |
Millimolar concentration of dNTPs, default is 0 |
saltcorr |
Salt correction method should be chosen when provide 'userset' Options are "Schildkraut2010", "Wetmur1991","SantaLucia1996","SantaLucia1998-1", "SantaLucia1998-2","Owczarzy2004","Owczarzy2008". Note that NA means no salt correction. |
DMSO |
Percent DMSO |
fmd |
Formamide concentration in percentage (fmdmethod="concentration") or molar (fmdmethod="molar"). |
DMSOfactor |
Coeffecient of Tm decreases per percent DMSO. Default=0.75 von Ahsen N (2001) <PMID:11673362>. Other published values are 0.5, 0.6 and 0.675. |
fmdfactor |
Coeffecient of Tm decrease per percent formamide. Default=0.65. Several papers report factors between 0.6 and 0.72. |
fmdmethod |
"concentration" method for formamide concentration in percentage and "molar" for formamide concentration in molar. |
DNA_NN1: Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746>
DNA_NN2: Sugimoto N (1996) <doi:10.1093/nar/24.22.4501>
DNA_NN3: Allawi H (1998) <doi:10.1093/nar/26.11.2694>
DNA_NN4: SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800>
RNA_NN1: Freier S (1986) <doi:10.1073/pnas.83.24.9373>
RNA_NN2: Xia T (1998) <doi:10.1021/bi9809425>
RNA_NN3: Chen JL (2012) <doi:10.1021/bi3002709>
R_DNA_NN1: Sugimoto N (1995)<doi:10.1016/S0048-9697(98)00088-6>
DNA_TMM1: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>
DNA_IMM1: Peyret N (1999) <doi:10.1021/bi9825091> & Allawi H T (1997) <doi:10.1021/bi962590c> & Santalucia N (2005) <doi:10.1093/nar/gki918>
DNA_DE1: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>
RNA_DE1: Turner D H (2010) <doi:10.1093/nar/gkp892>
Junhui Li
Breslauer K J , Frank R , Blocker H , et al. Predicting DNA duplex stability from the base sequence.[J]. Proceedings of the National Academy of Sciences, 1986, 83(11):3746-3750.
Sugimoto N , Nakano S , Yoneyama M , et al. Improved Thermodynamic Parameters and Helix Initiation Factor to Predict Stability of DNA Duplexes[J]. Nucleic Acids Research, 1996, 24(22):4501-5.
Allawi, H. Thermodynamics of internal C.T mismatches in DNA[J]. Nucleic Acids Research, 1998, 26(11):2694-2701.
Hicks L D , Santalucia J . The thermodynamics of DNA structural motifs.[J]. Annual Review of Biophysics & Biomolecular Structure, 2004, 33(1):415-440.
Freier S M , Kierzek R , Jaeger J A , et al. Improved free-energy parameters for predictions of RNA duplex stability.[J]. Proceedings of the National Academy of Sciences, 1986, 83(24):9373-9377.
Xia T , Santalucia , J , Burkard M E , et al. Thermodynamic Parameters for an Expanded Nearest-Neighbor Model for Formation of RNA Duplexes with Watson-Crick Base Pairs,[J]. Biochemistry, 1998, 37(42):14719-14735.
Chen J L , Dishler A L , Kennedy S D , et al. Testing the Nearest Neighbor Model for Canonical RNA Base Pairs: Revision of GU Parameters[J]. Biochemistry, 2012, 51(16):3508-3522.
Bommarito S, Peyret N, Jr S L. Thermodynamic parameters for DNA sequences with dangling ends[J]. Nucleic Acids Research, 2000, 28(9):1929-1934.
Turner D H , Mathews D H . NNDB: the nearest neighbor parameter database for predicting stability of nucleic acid secondary structure[J]. Nucleic Acids Research, 2010, 38(Database issue):D280-D282.
Sugimoto N , Nakano S I , Katoh M , et al. Thermodynamic Parameters To Predict Stability of RNA/DNA Hybrid Duplexes[J]. Biochemistry, 1995, 34(35):11211-11216.
Allawi H, SantaLucia J: Thermodynamics and NMR of internal G-T mismatches in DNA. Biochemistry 1997, 36:10581-10594.
Santalucia N E W J . Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes[J]. Nucleic Acids Research, 2005, 33(19):6258-67.
Peyret N , Seneviratne P A , Allawi H T , et al. Nearest-Neighbor Thermodynamics and NMR of DNA Sequences with Internal A-A, C-C, G-G, and T-T Mismatches, [J]. Biochemistry, 1999, 38(12):3468-3477.
ntseq <- c("AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC") out <- Tm_NN(ntseq,Na=50) out out$Optionsntseq <- c("AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC") out <- Tm_NN(ntseq,Na=50) out out$Options
The Wallace rule is often used as rule of thumb for approximate melting temperature calculations for primers with 14 to 20 nt length.
Tm_Wallace(ntseq, ambiguous = FALSE)Tm_Wallace(ntseq, ambiguous = FALSE)
ntseq |
Sequence (5' to 3') of one strand of the DNA nucleic acid duplex as string or vector of characters (Note: Non-DNA characters are ignored by this method). |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE. |
Junhui Li
Thein S L , Lynch J R , Weatherall D J , et al. DIRECT DETECTION OF HAEMOGLOBIN E WITH SYNTHETIC OLIGONUCLEOTIDES[J]. The Lancet, 1986, 327(8472):93.
ntseq = c('acgtTGCAATGCCGTAWSDBSY') #for wallace rule out <- Tm_Wallace(ntseq,ambiguous = TRUE) out out$Optionsntseq = c('acgtTGCAATGCCGTAWSDBSY') #for wallace rule out <- Tm_Wallace(ntseq,ambiguous = TRUE) out out$Options